Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11308D5
Clone ID IST11308D5
Vector VICTR76
Project tigm

Sequence tag IST11308D5HMF2
Sequence
GCATTTATTAAACTCTTTGACATTAAAATATTANATTTTGAAAATAAAGGTAAGACTTAAATAGTGTGCATGGGAATGCA
CTAAATAGTATGCACGGAGATACAATTTCTCTCTTTTTTGTCTTTTAANAAGTTAAAGTTTTAAAATTTTACAATACCTA
AACCTTTGAATTAATAACTANTTA
Sequence Type genomic DNA
Unitrap ID UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469503..7469685 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52079197..52079379 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 87789267..87789449 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919810..52919992 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940229..136940411 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 91356447..91356629 177
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124749541..124749723 177
NO GENE  


Sequence tag IST11308D5BBF1
Sequence
GCATTTATTAAACTCTTTGACATTAAAATATTANATTTTGAAAATAAAGGTAAGACTTAAATAGTGTGCATGGGAATGCA
CTAAATAGTATGCACGGAGATACAATTTCTCTCTTTTTTGTCTTTTAAGAAGTTAAAGTTTTAAAATTTTACAATACCTA
AACCTTTGAATTAATAACTAGTTGACAAAACATTTTANATACTTGGCTGTAAAGGGGCANTGACTAATTGCACTTTTAAT
NNATTTTTTTAAGGAGCAGTTGTAACTAGAAGGCTTGTAAAGTTATNNNNAGTTACATGTGCATAATTTATTTATTAACT
ANAAATATGCATAANCAATTGTAAATTTGANAATTAATAGTATCTGAGGGATGAACAATTTAAGCAATTGCGAGCTCANA
NATATGGCATTGNNNNTNAATATNCAAATTAAGGTTTGATTGTTTANCATTTTAAAACACCNTNTACAGCACACAACTAN
NTNATCTGTGCTGGAACAGGGGAAACTGTGTCTTNNGACTCCNCCCCCACAGAANCNNNTTGGGNCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es