Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13693B11
Clone ID IST13693B11
Vector VICTR74
Project tigm

Sequence tag IST13693B11HMF1
Sequence
AATCTACTTTCCTATCGATACCCCAGAGTTCTTACTTACTACTTAATATGTTTCATCTGAGCTGCTCTTAACTCTAGTTG
GCCAGCCA
Sequence Type genomic DNA
Unitrap ID UNI23119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108249989..108250075 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013150 (Gfod2) NM_027469 glucose-fructose oxidoreductase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917825]

 
Come back to gene ENSMUSG00000013150


For any suggestions or comments, please send an email to unitrap@crg.es