Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W174D04
Clone ID W174D04
Vector ROSAbetageo
Project ggtc

Sequence tag W174D04
Sequence
TTCTCGGCCCCGNNNGGGTCTCCCGGCTGGGGGCCCCGTTCTTCCGGTCGCGAGCACCCCAGGGTGTAGAGGGCGGTCGC
GGCGGTCGCCTGGGCAGCGGTGGCAGAATGTTGGCTTCCAGAGCGCTGAGCCTGATTGGCAAGAGAGCCATTTCTACTTC
GGTGTGCCTTCGAGCACATG
Sequence Type mRNA
Unitrap ID UNI6307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123192150..123193282 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031818 (Cox4i1) NM_009941 cytochrome c oxidase subunit IV isoform 1 Gene [Source:MGI Symbol;Acc:MGI:88473]

 
Come back to gene ENSMUSG00000031818


For any suggestions or comments, please send an email to unitrap@crg.es