Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14475H6
Clone ID IST14475H6
Vector VICTR74
Project tigm

Sequence tag IST14475H6HMR1
Sequence
GANCCNATGCGACCTTAACCGTTGAGCTCTCTCAGCTCCCCTCCCCCTCTTGTGAGATGGCTTCTTATTGTANACCAGGC
TGTTTTCAACTTTGCTATGTAGCTGAGGGTGACCGTAAGCTTCTGATCTTCCTGCCTCTACTTTCCGAGTGCCGAATTTA
CAGGGGTGCGGGCCACACACAGTTCCTGAGGGATTAGAGATAGAACCCAGGGCTGCCTGGGTTTGCACTAAGCAAACACT
CTACCAACTGANCTGCAGCCCCAGCGCTGTGCCAGTGGCAGTCATATCTCANGGATGGGGCTGGAAAGAATGCCCGAAGT
GTGCCANTTATATATTGCATGTCTTAANACCTTGCATGTTTTANAGAAGTGAANCANGGATTCCTGGGCATGCNNGGACA
CCTANCANNNCTGTTGANACN
Sequence Type genomic DNA
Unitrap ID UNI32340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30962785..30963199 381
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es