Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F052A06
Clone ID F052A06
Vector pT1ATGbetageo
Project ggtc

Sequence tag F052A06
Sequence
TGATGAGAGCATTGCCAAGGACATGTCCCTGAAGGACTCAGGCAGTGATCTCTCTCACCGTCCCAAGCGACGTCGATTTC
ACGAAAGGTACAATTTCAACATGAAGTGTCCTACGCCGGNNNGCAACNNNGTAGG
Sequence Type mRNA
Unitrap ID UNI5671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95161300..95161426 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]

 
Come back to gene ENSMUSG00000038909


For any suggestions or comments, please send an email to unitrap@crg.es