Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13169F8
Clone ID IST13169F8
Vector VICTR74
Project tigm

Sequence tag IST13169F8HMF1
Sequence
GTCTAATGGAAAAGTCTCTGACCTTTTTTGATTTGATTTCTTCCACTTATGGCTATGCGCCATCANACAGGTCAGTGGAC
TTAATTTATTCTAGAACTGGGGGCAGAATCACTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84856917..84857033 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST13169F8BBF1
Sequence
CTTTGTTTTGGCTGAGCAAGATGAAAGCGGCAACCACAGACCCCAGGGACCAAGAACTGGAACTAGGTACCGCCTGTTGT
GGTAACTCTCTTTTCTTCAGTCGGGGCCTGCCCTTTCTCATCTCTTCCTTCTAGTCAAGCTCTAACGCTCTCCCTCCGAC
TCCATCGGTCCCTATCTTCCCTCCTTCACCCCCTTTGCACACAACTGCTTTGTATTTTCGTTGAACGGGGACCTCCTGGT
GCTCCCTCCAGCTTTAGCAGGGATTCCAGGAGCCTGGTGGTGTTCTCTAGAGCNNTGGGCTAGTTAGCATTGTAACACGC
GATTCAGTTGANAAACTACGGTGGGAGCCNGGGCAAACGCGCGTGTCNAGTGGGCGTTGGGGTTCCTCANGACAAAGCAC
AATTAGACAATGAGGACCTTGCCTCCCTCCCGGANNCCTAACACAGCTTCCCTCGGGCACCCACGGANCGTGCGTGTTTA
CACTTCTCTACNCCCGGCGNCNGANCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 32184840..32185343 480
 
EST/CDNA Est Name
  BX630080.1

 
Come back to gene BX630080.1


For any suggestions or comments, please send an email to unitrap@crg.es