Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14260B9
Clone ID IST14260B9
Vector VICTR74
Project tigm

Sequence tag IST14260B9HMR1
Sequence
GTATGCACCACCATACCTAAGTTTATGTGGTGCTTGGGATCAAACCCAGTGTTTGATCCGCTGGTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI12754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 100430402..100430470 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032475 (Nck1) NM_010878 non-catalytic region of tyrosine kinase adaptor protein 1 Gene [Source:MGI (curated);Acc:Nck1-001]


Sequence tag IST14260B9BBF1
Sequence
TTACCTGTAATCCCACAGCTGAATATTAAGCTTGAGGCCAACCAGGGTTATGAGACCCTAGCTAAACAAGTAATTAAGCC
TTCAAAGGCCAGCAAAATGACTCANCAGATAAATAAAGGCACTTGTCACACAAGCCTGGANACTGAGTTCAATGCCCCCA
GTCCATTTAGAGACAGAAGAAAATCTACTGCACAAAGTTGTCCTCTGATTTCTATACATGAACTGGCACATGTGCCACCC
CCCCACACACACACACACACACATCNNGTATACACACACTNNNGANCACACACACACACACANANNNNCACACAANANNN
ACANNTTTTNANANANNTCNANAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032475


For any suggestions or comments, please send an email to unitrap@crg.es