Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W055D01
Clone ID W055D01
Vector pT1ATGbetageo
Project ggtc

Sequence tag W055D01
Sequence
GGGGGGGCGATGGACCCGCTGCCCTCGCCGGCAGTCGCTGCAGCTGCTGAGGCGGAGGCTGACGAGGAGGCGGATCCGCC
GGCGACAG
Sequence Type mRNA
Unitrap ID UNI9642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140865102..140865183 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029560 (Snx8) NM_172277 sorting nexin 8 Gene [Source:MGI Symbol;Acc:MGI:2443816]

 
Come back to gene ENSMUSG00000029560


For any suggestions or comments, please send an email to unitrap@crg.es