Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14932F6
Clone ID IST14932F6
Vector VICTR76
Project tigm

Sequence tag IST14932F6HMF2
Sequence
CTGGCACCCTGCACTCCCACACCCCACGGACTCCGGCGCCCCCCACTCCTCACCTCCATCACTCCATCCATCCCCCACTG
GCCTGGACTGCACCACANAGTTTTTCCACTCTTCCCTTGCACCTCCGCTCACTTCCAGCCTTCGGGGTTCTGACAGTCCT
CAANACCCTGACATTGCCTANACACCCCTATATCCCCAACCCCAAACGGCCCCAACTCCCTGACATCACACTCCTCTGTC
CCCTGGCGCCTCTGGCGCAAGACCTTCCCGGACAAGCTCCGTCTGTCTGATTACANAAAGCTCCCATCCCATTCCAGTAT
TACTGTCNANGCAGCCNNCNCCN
Sequence Type genomic DNA
Unitrap ID UNI33161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 51858154..51858489 320
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062785 (Kcnc3) NM_008422 potassium voltage gated channel, Shaw-related subfamily, member 3 Gene [Source:MGI (curated);Acc:Kcnc3-001]


Sequence tag IST14932F6HMR1
Sequence
NTGAAACCTGTGTGGTACTGGGACGATTGATGCTGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97650405..97650441 37
NO GENE  


Sequence tag IST14932F6BBF1
Sequence
ATGTGTCTGGACCTACTTTTCTCTTCTTCGTCTCTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97166417..97166463 45
NO GENE  

 
Come back to gene ENSMUSG00000062785


For any suggestions or comments, please send an email to unitrap@crg.es