Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F038A01
Clone ID F038A01
Vector pT1ATGbetageo
Project ggtc

Sequence tag F038A01
Sequence
CCACCTGCATGCGGCGCAGCTTCATCCAGAGCACTTTCAGCATCAACCCAGAAATCGTCTGTGACCCCTTATCTGACTAC
AACGTATGGAGCATGCTTAAGCCTATAAATACATCTGTGGGACTAGAACCTGACGTCAGGGTTGTGGTTGCGGCCACACG
GCTGGATAGCCGGTCCTTTTTCTGGAATGTGGCCCCAGGGGCTGAAAGTGCTGTAGCCTCCTTTGTCACTCAGCTGGCTG
CAGCTGAAGCTTTGCACAAGGCANNTGATGTGACCACTCTATCCCGAAATGTGAGGCTTGTCTTCTTCNNNGNAG
Sequence Type mRNA
Unitrap ID UNI11339

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 174002258..174002958 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003458 (Ncstn) NM_021607 nicastrin Gene [Source:MGI (curated);Acc:Ncstn-001]

 
Come back to gene ENSMUSG00000003458


For any suggestions or comments, please send an email to unitrap@crg.es