Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10090E9
Clone ID IST10090E9
Vector VICTR75
Project tigm

Sequence tag IST10090E9BBR1
Sequence
TAGTCTGGGTTCTAGAAGCCCAGACTTGCACTTCACAAAGTTCTTGATCTCAATGAATGTGTGCTCGACACTCAAGATTT
AATTTATTCTTAAGGGCAGGGATGGGAAGATAGTGGGGACCGTTTGATCGTTTTTGAGCTCGGCCTTTTCCTTCTGACCT
CTTGCTTTTTTGTGTTTAGTTTGGTTCCTGACAGCTTTATTACCGTTATGTTGTAAATATTACTCTGGAGAGAAAAAGGC
CCCGGTTCTCACCATCTTCATTGGAGGAAACCATGAAGCCTCAAACCATTTGCAAGAGTTACCCTATGGTGGCTGGGTAG
CGCCGAATATTTATTATTTAGGTATGTGTTTATGTGCACTTTTTTTGGTCTTGTCAGAATCTGTACCAGCTGGGCAGCTT
CTAGAAGACATGTGGTGAATGCCATTAACTTAAATAATCATGAGAATTGAGTTAAAATAGTTATTAAATGGCCAGTCATG
AACATACATCCATTTTCTTCTAGAGGTTTAAATAATAGCTAATATGATGACAGTTTTTTTTTTTGG
Sequence Type genomic DNA
Unitrap ID UNI33163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99476779..99477324 540
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032469 (Dbr1) NM_031403 debranching enzyme homolog 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1931520]


Sequence tag IST10090E9BBF1
Sequence
CTAGCACACAGCAGGTCACGGGAAAACCAGATCATTAAATCAACTAACCATCGTGTTCTAGCAAATCCAAAGTATCTAAA
CCTGCTGGTGTCACCCCGGGTCCCTGGGATGTTGAGCCAGGTGTGTACAGAGAGGAGGAGGCCAGGGCCATTTCCTAAGC
TCCGGGTCCAACAGACATCGCGATCTGCGGCAGCAGGACCTGGAACCCCACGCGAGGACCGGCCGCGCGCCCCTCACCTG
TAGATGGTCTGCATGTGACGGTACTTGGGCGGCACGGCCATGCAGCGCAGGTCGGCCTCGTTGCGCACCGCCTGGAAGTC
GCCGCAGCACAGAAGGAGATCCACGGGTCCCGAGCCGCGCCGCTCCGCCAGCGCCAGAGTCTCGTAGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99476394..99476781 380
NO GENE  

 
Come back to gene ENSMUSG00000032469


For any suggestions or comments, please send an email to unitrap@crg.es