Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14805C6
Clone ID IST14805C6
Vector VICTR76
Project tigm

Sequence tag IST14805C6HMF2
Sequence
ACCNCCCGTAATGAGATCTGATGTCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATA
AATCTTTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI30988 UNI33166

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 14261727..14261823 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 77516353..77516449 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51091206..51091302 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020385 (Clk4) NM_007714 CDC like kinase 4 Gene [Source:MGI (curated);Acc:Clk4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107693646..107693742 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032582 (Rbm6) NM_029169 RNA binding motif protein 6 Gene [Source:MGI Symbol;Acc:MGI:1338037]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12362537..12362633 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73151510..73151606 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 86872217..86872313 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121381265..121381361 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 48406795..48406891 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101167273..101167369 93
NO GENE  


Sequence tag IST14805C6HMR1
Sequence
GCCNCCGTGNGGTTGCTGGGATTTGAACTTCGGACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCNTCTCAC
CANCCCTCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032582


For any suggestions or comments, please send an email to unitrap@crg.es