Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15073D5
Clone ID IST15073D5
Vector VICTR80
Project tigm

Sequence tag IST15073D5HMR1
Sequence
CTGGTTNAATTTAACCTTTGAAAAGCTGCTGTGGAGAGGAGGGGGAGGGAATGACCTTTCTTTCCTTANACTGGGCTGTG
GTGGTGGTGGGGGGGTGN
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117081983..117082079 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST15073D5BBF1
Sequence
CAGCCCACCCCACCCCCTTCACGCCCACCCCCAAACAAGAGAGGAAAAGTTAATTGAAAACGCTGTTTAATTTTTCAGCT
CCAGTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117082077..117082166 90
NO GENE  


Sequence tag IST15073D5HMF1
Sequence
CAGCCCACCCCACCCCCTTCACGCCCACCCCCAAACAAGAGAGGAAAAGTTAATTGAAAACGCTGTTTAATTTTTCAGCT
CCAGTGGATCCTGCCCCAGCACAGATGGCTCCCCCAGGACTGTCTGCCCCTAGCCCATCTCTACCACTCCACACGCCCCC
CTACCCCCATCAAGCATGGGGGCTGAGGCACCGTCAGCAGTGGCTCAAAGGGAGAAAAAAGAGAAGGGGGACCATGTGGG
GGGGGGNNNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117082077..117082322 246
NO GENE  

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es