Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0051
Clone ID AY0051
Vector pGT0lxr
Project sanger

Sequence tag AY0051
Sequence
AGCAGGTTTTTTCTTTCTGTAAGACTGCTGTAAGTGAAAAAATGTTACGGCATACAGGTCGAGTTGTGGGGATAATAAAA
AGGAACTGGAGACCGTATTGTGGCATGCTTTCCAAGTCTGATATTAAGGAGTCAAGAAGACATCTCTTTACACCCGCTGA
TAAGAGAATTCCACGAATTCGGATAGAAACCAGACAGGCTTCTGCGTTAGAAGGACGTGGTTGTGAGCTCTTCTAGATGG
TTGGCCTAGAAATTTTAGATATCCAAATGGACACTTTGTAAAGAATTTAGGCGATGTTGGAGAGAAGGAGACAGAAACGG
AAGTGTTGCTGCTCGAGCACGATGTTCCTCATCAGCCCTTTTCCCAGGCTGTGCTTAGCTTCCTGCCCAGGATGCCCTGG
AGCATTACTGAGGAG
Sequence Type mRNA
Unitrap ID UNI1914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 99487981..99489310 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033166 (Dis3) NP_082591 DIS3 mitotic control homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919912]

 
Come back to gene ENSMUSG00000033166


For any suggestions or comments, please send an email to unitrap@crg.es