Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15051G1
Clone ID IST15051G1
Vector VICTR80
Project tigm

Sequence tag IST15051G1BBF1
Sequence
CAGAGAACTGTTTCTGACACGTCCTATGACTTCCCAGGTAAGCTGCTGTTTTGTGTGCATCTGCAGACTGAATAAAATGG
TCAGCATATAAGAGGTGGAGGCAAAACTATGGCTGCAAGTTCCTAGTCAGTCTGTTCTATTTAGTGAGTTTCATGACAGC
CAGGGTTACATATAGTGAAACATTGGCTCAAAGGGATTTAAAAAAAAAGAAAAAGAAAAAGAAAAATTCCTTCCCAACAG
CTGATTCTCTATAAAATCAAATGTGGAATAACATTTGGGTAANAACNAAAGGGGCTGGANAGANGGCTCANCAGTTNANA
GCACCGACTGCTCTTCCNGANATCCTGANTTCAATTCCCAGCAACCACATGGTGGCTCGAANCCNTCTGNAANGGGATCC
GATGCCCTCTCCTTTNNNNNCNTTACATAAATAAATCNNAAAAAAAAAGAANAANNAANCNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15051G1HMF1
Sequence
CAGAGAACTGTTTCTGACACGTCCTATGACTTCCCAGGTAAGCTGCTGTTTTGTGTGCATCTGCAGACTGAATAAAATGG
TCAGCATATAAGAGGTGGAGGCAAAACTATGGCTGCAAGTTCCTAGTCAGTCTGTTCTATTTAGTGAGTTTCATGACAGC
CAGGGTTACATATAGTGAAACATTGGCTCAAAGGGATTTAAAAAAAAAGAAAAAGAAAAAGAAAAATTCCTTCCCAACAG
CTGATTCTCTATAAAATCAAATGTGGAATAACATTTGGGTAANAACTAAAGGGGCTGGAGAGATGGCTCAGCAGTTAANA
GCACCGACTGCTCTTCCAGAGATCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCGAAACCNTCTGTAANGGGATCC
GATGCCCTCTCNTTTNCNTACNTTNCATAAATAAATCNTAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 54055396..54055843 428
 
EST/CDNA Est Name
  AA024318.1 - AA014217.1


Sequence tag IST15051G1HMR1
Sequence
CTGTTGTCNTCTTATGGGACCCAGGGATTAAATTGAGGTCNTCAAGTCACTCAATGCAAAAATACATATTTATTGTAGGT
AATCAGGGAAGAAAACAATCAACTTGTTGTCTGTCCTTCTAGTCATACATACATGCAGAACATACATGTCATAGGTAGTT
AGCTCTGATGTCC
Sequence Type genomic DNA
Unitrap ID UNI13524

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 54055841..54056012 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006599 (Gtf2h1) NM_008186 general transcription factor II H, polypeptide 1 Gene [Source:MGI (curated);Acc:Gtf2h1-001]

 
Come back to gene ENSMUSG00000006599


For any suggestions or comments, please send an email to unitrap@crg.es