Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F062D02
Clone ID F062D02
Vector pT1ATGbetageo
Project ggtc

Sequence tag F062D02
Sequence
CGTGGAGATAAAAGAAGTCGGCATTCATTCAGCGGCTGCCTTTGTCTTCTTCCAAGCCTGCCTGAAAATGTCATACTTCG
GCCTGAGACTTCAACGA
Sequence Type mRNA
Unitrap ID UNI11427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48310560..48310651 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072419 (Dppa2) NM_028615 developmental pluripotency associated 2 Gene [Source:MGI Symbol;Acc:MGI:2157523]

 
Come back to gene ENSMUSG00000072419


For any suggestions or comments, please send an email to unitrap@crg.es