Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14727G9
Clone ID IST14727G9
Vector VICTR76
Project tigm

Sequence tag IST14727G9HMF1
Sequence
GGGGCATGTCTTTAATCCTAGCACTTGGGAGGAAGAGACAGATCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117527107..117527151 45
NO GENE  


Sequence tag IST14727G9HMR1
Sequence
CCCACGCCTGGGAAAGAACACAAACCATCAGAAGTTAGTAGTAAAATATCCCACTTTAAAACAGAANAGATTTCCACAGA
TGTTTCATCAGGTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI31092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117527149..117527245 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025571 (Tnrc6c) NM_198022 trinucleotide repeat containing 6C Gene [Source:MGI (curated);Acc:Tnrc6c-001]


Sequence tag IST14727G9BBF1
Sequence
TGGGGCATGTCTTTAATCCTAGCACTTGGGAGGAAGAGACAGATCATTTCTGTGAGTTCAAGGTCAGCCAGGGATGCATA
ATGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117527064..117527152 89
NO GENE  

 
Come back to gene ENSMUSG00000025571


For any suggestions or comments, please send an email to unitrap@crg.es