Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13105C8
Clone ID IST13105C8
Vector VICTR76
Project tigm

Sequence tag IST13105C8BBF1
Sequence
CTGAGAATGGGGCTCTCGTGAGTATTTCGATCTCTCAGAGAGCACTTCTGGCCACTTAATAGACCAGTTGCAGCTGGGTT
TTCAGATGTGGATTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84778751..84778849 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]


Sequence tag IST13105C8HMF2
Sequence
GGAGGAGACACTGCAACTGGGTCCATTTAACAGCTGAGAAAAACCGAGCCAGGGCGAACTGGTTTCCAACCGCATTCGCG
GCCGACCATGAGATTTTCTGGGCCATGATGGCTCTCACAGTCACTGGCTACCAACAAGCCCTCTCGGCCCCCGATGCTAG
ACCACAGTTCCCATACGCCCCAACGCTCCCACTGTGCCCTCAGTCCCGGAAGCGGAACTCCCTGCGCAAGAAGGGCGGGA
CCAGTATGGCTTGCAATTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34000876..34001135 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037313 (Tacc3) NM_001040435 transforming, acidic coiled-coil containing protein 3 Gene [Source:MGI (curated);Acc:Tacc3-003]

 
Come back to gene ENSMUSG00000037313


For any suggestions or comments, please send an email to unitrap@crg.es