Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15069D12
Clone ID IST15069D12
Vector VICTR80
Project tigm

Sequence tag IST15069D12HMR1
Sequence
NNATNNGCTGGGAAAAGTGAACAGGGTGCTTCTCTTGGAGTCNGAGTTAGAGCCGAGGAGAGGGTGGCAGGTATGAGGGC
TGGGCGCTTCTGGAACGCTAGTGAAGCTTCTTTGCAATTGTTGAATGGTAAGGTAGGGAATGGTGTAGGAAAGGGAACAC
TCAGAAAAATACCATGAAGTCACCCACTTTAGAATTCTAGATTTATTGAAGGAACTACATTTTGGTGTTCTTACCTGTGA
CCTGTGTCTTGGAACACAGCCTGCTTCATGAAGTTCTGACATTTATTGTTATTTTTGCTTCTTTGTTTGAGTTATGGTCT
TTTGTAACCTGGGTTGGCCTTGAACTCACTATATAGCTAGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI16126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116754539..116754896 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031024 (St5) NM_001001326 suppression of tumorigenicity 5 Gene [Source:MGI Symbol;Acc:MGI:108517]


Sequence tag IST15069D12BBF1
Sequence
TTATGAATTCCAGACGGTTATCAACCTGACTTCCGAACCCCAGGCTTCAGGTCTGTGCTTCTCTCTTAATCACACCAGCA
GAAGCTCTTGTAGGAGGAGATGAAGCAGGAAGGAAATCAGAACAATATAACATCAACGGAAGTCCCACAGTTCATACCTT
TTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116754898..116755064 167
NO GENE  


Sequence tag IST15069D12HMF1
Sequence
CTATGAATTCCAGACGGTTATCAACCTGACTTCCGAACCCCAGGCTTCAGGTCTGTGCTTCTCTCTTAATCACACCAGCA
GAAGCTCTTGTAGGAGGAGATGAAGCAGGAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116754897..116755007 111
NO GENE  

 
Come back to gene ENSMUSG00000031024


For any suggestions or comments, please send an email to unitrap@crg.es