Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W059F06
Clone ID W059F06
Vector pT1betageo
Project ggtc

Sequence tag W059F06
Sequence
GAGCGCGTGCGCGGTGAGGGGCGCGCGGCTTACTGCCGTTGGGAACTTGCGCGCGGCCTGCGGGAGCGGGCGCCTGCTGT
GACCCTTCTGNANNNNTGCGTTTGGTGAGAGCGGCGGCTTGCCGCTGCTACCAAGGGCGGGCAGCGCTTGGTGTTTCCTG
CAAGCGAGGCCCGCCCCCGGATCTCTGCTGTTCTGGCATCAGCACCGCCGGCCCTGGGCAACGATGTACAGCGAGGACCC
TTAGCTTCGGGGCGAGGGAGGCCTCCCGG
Sequence Type mRNA
Unitrap ID UNI12416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28980801..28981069 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043535 (Setx) NP_932150 senataxin Gene [Source:MGI (curated);Acc:Setx-001]

 
Come back to gene ENSMUSG00000043535


For any suggestions or comments, please send an email to unitrap@crg.es