Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12965E7
Clone ID IST12965E7
Vector VICTR76
Project tigm

Sequence tag IST12965E7HMF1
Sequence
AAAGTTCAGCAGGAAAAGGCTCAGGTAGAGTCCGCCAGACTGGGCAGCACGTCTGCGGGAGGAGGAGCCCCGCAGCACTG
GGAGGAGCCTGAGCAGGCGGGCTGGAGCGCTGCGCACCAGGAAGTGACTGGCCCCTGCAACCCCTTCGCGCCATCCGCTG
GTATTTTAGTTTGCCACTGCACGTCCGTCCAAGGCCTTAGTGACTCCCAAGGAGTCCCGGGTAAGTANCCTGGAAAACCC
GGANTAGTGAGTGTTTGGGACAGGGAGGAGGCGGGGAGGAGGCGGGGA
Sequence Type genomic DNA
Unitrap ID UNI33169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 130811318..130811604 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067369 (4732479N06Rik) NM_172540 TRM2 tRNA methyltransferase 2 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2442530]

 
Come back to gene ENSMUSG00000067369


For any suggestions or comments, please send an email to unitrap@crg.es