Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W031F03
Clone ID W031F03
Vector pT1betageo
Project ggtc

Sequence tag W031F03
Sequence
TCACCCGCTCTTCAGCCAGGTTAAGCCAGAGTTCCCAAGATTCCAGCCCTGTTGGAAATTTGCCGTCTTTCGGCATTGAG
GAGCCTGCCTATTTTACCAGAAGGGTGACCCGTAGTCAGCAGCAGCCCACGCCAGTGACTCCAAAAAAGTACCCTCTTNN
ACAGACTCGCTCATCTGGCTCTGAAACGGAGCAGGTGGTGGACTTTTCAGATAGAG
Sequence Type mRNA
Unitrap ID UNI5647

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95164447..95167401 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]

 
Come back to gene ENSMUSG00000038909


For any suggestions or comments, please send an email to unitrap@crg.es