Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0030
Clone ID AY0030
Vector pGT0lxr
Project sanger

Sequence tag AY0030
Sequence
GCATCTGCAGAATGGGCACACCGGTGCATCTGGGTGGGTTCTGCTTGGCCGGGCCTGAAAGGTGGACCACTTGTTGCAAC
CATGGTCGTATCGCCCAGCAGAGTGAAAGCCTCAAACCCCGCGCTTCGCTGTCAGTCGGTCCCCAGAACCAATGGAGGAG
AACGAGGTGGAGAGCAGTAGCGACGCGGCCCCTCGGCCCGGCCAGCCTGAGGAGCCTTCTGAGAGCGGCCTGGGTGTGTG
CACCTCGGAAGCTGTGTCCGCGGACAGCAGCGACGCTGCGACCGTCCCAGGATTAACGGAGGCTGACGACTCTGGCGTCG
GGCAGAGCTCGGACGGTGGCAACCACTCTGTG
Sequence Type mRNA
Unitrap ID UNI1917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164736122..164736473 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039834 (Zfp335) NM_199027 zinc finger protein 335 Gene [Source:MGI (curated);Acc:Zfp335-001]

 
Come back to gene ENSMUSG00000039834


For any suggestions or comments, please send an email to unitrap@crg.es