Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W043A05
Clone ID W043A05
Vector pT1betageo
Project ggtc

Sequence tag W043A05
Sequence
CTGCCCTGGGGAACAAAGTCGTGGAAAGCCTAAGGGCACAGGATCCCTCAGAAG
Sequence Type mRNA
Unitrap ID UNI12419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90286711..90286764 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001016 (Ilf2) NM_026374 interleukin enhancer binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1915031]

 
Come back to gene ENSMUSG00000001016


For any suggestions or comments, please send an email to unitrap@crg.es