Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14387D9
Clone ID IST14387D9
Vector VICTR74
Project tigm

Sequence tag IST14387D9BBF1
Sequence
ATTTTATTGAGACAGGGTCTTGTTAGGTATCCCAGGCTGGCCTCTAACTTAGTCTCTGGCACAGGAGAGCTGAATCCAGC
TTAAAAATCCCTTTCCACAGGCAAGGGAGCTGCATCCCCTATCCTCTGACCCTCGGTTTTCCTTTTTCTGGCCCTCACTC
AACAGTTCCTTCAGGGAATATGACCCCAAGGCTCTCCTCAAAAACCCCAAACTTCCCCACATCCACAAACCTTCCTGGGA
TCT
Sequence Type genomic DNA
Unitrap ID UNI33171

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109250403..109250644 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070424 (Art5) NM_007491 ADP-ribosyltransferase 5 Gene [Source:MGI (curated);Acc:Art5-001]


Sequence tag IST14387D9HMF2
Sequence
TTTGGNNGNNNNTCCGGGATCAGGAGACCCCTGCCCAGGGACCANCGACCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000070424


For any suggestions or comments, please send an email to unitrap@crg.es