Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W046D08
Clone ID W046D08
Vector pT1betageo
Project ggtc

Sequence tag W046D08
Sequence
GCCTGAGAAGGACTTTGTAGAGAAAGCAAAGCCATCACCTCATCCCACAAAGGACAAACTGAAAGGAAAGGATGAAACGG
ATTCTCCCACAGTGCACTTGGGCTTGGATTCGGACTTGGAGAGCGAACTTGTCATAGACTTAGGAGAGGATCCTTCTGGG
AGGGAGGGTCGAAAAAACAAGAAAGATCCCAAGGTGCCGGTGGCGCTGAGCAAGCCG
Sequence Type mRNA
Unitrap ID UNI113

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165637849..165638063 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es