Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12460B5
Clone ID IST12460B5
Vector VICTR76
Project tigm

Sequence tag IST12460B5BBF1
Sequence
CCTGCGCTATTATTGCACCGTTTAAAAACCTCCGACNGATTTCAATTCGTTAAACTANTTCTCCATCCGTTACTCTAAAC
TCCTCCCGGACCGGATGGTTTAGCAGCGGCGCCCCGGCGTCCAGACCACGCGTCACCGCCCCCCATGGACGCCCCGAGAC
GCGCAAATTGAGCGCTGTGTCTTTAAGGGGGAATCGGCCTTTTCCGTCCAGGACAAAATGTNTGCNAGGANCCNGGAGGC
GAGGGGCNACCATCNNGGCNTCCGGGTGANCGTGGCTGGCTGGGGCTCGGTGGCGTGNCTTGN
Sequence Type genomic DNA
Unitrap ID UNI14715

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 96095035..96095336 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041995 (Zbed3) NM_028106 zinc finger, BED domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1919364]

 
Come back to gene ENSMUSG00000041995


For any suggestions or comments, please send an email to unitrap@crg.es