Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A024A07
Clone ID A024A07
Vector pT1betageo
Project ggtc

Sequence tag A024A07
Sequence
GGCCTGAGCCACAGTCAGANNNCGACCCCANNGCCACTCCNANNNGGNNNNGGGTGGGGANNAAGAGCCAGNNNGCCAGA
GAGTGTTTCCCATNNNTGCAAAGCCTTCATTGTNNNCTCCTCCTNNNTCTATCCNNNTCTCATCCCCTATTAAACCAAAC
CCATTGGATCTGCCACAGCTTCAGCATCGAGCTGCTGTTATTCCACCAATGGTTTCTTGCACTCCATGTAATATACCAAT
TGGAACGCCCGTAAGTGGCTATGCTCTTTACCAACGGCACATTAAGGCCATGCATGAGTCAGCACTCCTGGAGGAGCAGC
GGCAGAGGCAAGAACAGGTAGACTTGGAATGCAGAAGCTCTACAAGCCCATGCAGCACTTCTAAGAGTCCAAACAGGGAG
TGGGAAG
Sequence Type mRNA
Unitrap ID UNI9235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62180466..62186659 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es