Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10856G3
Clone ID IST10856G3
Vector VICTR76
Project tigm

Sequence tag IST10856G3HMR1
Sequence
CCNACCTTTTCTGCTTGTAGAAGATGGGTGGTTTGTGCTCTGTAATCCTCCATTACTAAGAAATTTTGCTCTAGATTCCA
GGTAGTTTCCATGTTGTTTGTCTTTCTGGGGTTGGGTCACCTGACTCAGAATATTTTCTAGTTCCATCCATTTGCTTGCA
AATTTNATGATATTTTGTTTTNAANCATCTGAATAATATGTGCAAATGTANTGNATTTTCN
Sequence Type genomic DNA
Unitrap ID UNI26976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57420418..57420637 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031139 (Mcf2) NM_133197 mcf.2 transforming sequence Gene [Source:MGI (curated);Acc:Mcf2-001]


Sequence tag IST10856G3BBF1
Sequence
CTANGACATCAACCCNNCATAAAACCTTCCACCTACANTCTGTCCTNNTGTAATACTTGCTGGGGCAATGGTGGTGCANA
ACTTGTGGGAGTGGCCNACCTATAACTGATCTAATTTGTGGCCNTGAGAGGGAATCTACACCTGACATTGCGTGGATGTC
CAGGAACCANNNGCTGGACAGCCCANANACCCNNGATANAACCAAATATGACTGTCATTTAAAAANAGGAAAAGAANGCT
GGANAAANNACTT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10856G3HMF2
Sequence
CTAGGACATCAACCCAGCCATAAAACCTTCCACCTACAGTCTGTCCTAGCTGTAATACTTGCTGGGGCAATGGTGGTGCA
GAACTTGTGGGAGTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57420639..57420734 96
NO GENE  

 
Come back to gene ENSMUSG00000031139


For any suggestions or comments, please send an email to unitrap@crg.es