Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12973C2
Clone ID IST12973C2
Vector VICTR76
Project tigm

Sequence tag IST12973C2HMF2
Sequence
ATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGAATCAGATCTTGTTACACATGGTTGTGAGCCACCA
TGTGGTTGCTGGGATTTGAACTTCAGACCTTCGGAGAGCAGTCAGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCGT
A
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98514418..98514578 155
NO GENE  


Sequence tag IST12973C2BBF1
Sequence
ATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGAATCANATCTG
Sequence Type genomic DNA
Unitrap ID UNI31022 UNI31023 UNI31024

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 78348841..78348895 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20069093..20069147 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019992 (2610016C23Rik) NP_082206 RIKEN cDNA 2610016C23 gene Gene [Source:MGI Symbol;Acc:MGI:1919054]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 31333501..31333555 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21301619..21301673 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 51738154..51738208 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10692520..10692574 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 37205760..37205814 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079714 (Pcdha6) NP_031793 protocadherin alpha 6 Gene [Source:MGI Symbol;Acc:MGI:1298367]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5733091..5733145 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18043361..18043415 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51373999..51374053 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140696154..140696208 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 120691161..120691215 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 142423093..142423147 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4669494..4669548 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3302190..3302244 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98690250..98690304 53
NO GENE  

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es