Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12912H12
Clone ID IST12912H12
Vector VICTR76
Project tigm

Sequence tag IST12912H12HMF1
Sequence
CAGNNAGCATGGGTTGCAACAAGAAATAACAGTCTCCCTTCTGTCCTCTCCCTTTGCTGCCTCGGACCAGCCGAAGAAGC
AGGCATCGGAGACACCCCGAACCAGGAGGACCAAGCCGCTGGGCATGTGACTCAAGGTCAGTGGCCCAAATCGACTTTGG
GACTCAGATTGGGAGGAGGGAGATGGGAGCACTCAGTGGGCTCTACCTTGAAAAGACATCTTANCGCCAGGTCCTANGGC
ACAAGTTCAGGANACCCGAAGGAGTTGCCAATATCAAAGTTGGCCTCTGTAGACACANACAGCGTTTTCTTATACCATCC
TGGTTCAGGTCATGCCTANCCCGGGGATGANGCCNGTGGGTGACGCTCCCNCAGGGTGCCCTGTGGCCTGTCAATCACAT
CANCNNTGCACTTGTCATTCNAACTTNNNTN
Sequence Type genomic DNA
Unitrap ID UNI30785

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104156103..104156528 398
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST12912H12BBF1
Sequence
CAGAGAGCATGGGTTGCAACAAGAAATAACAGTCTCCCTTCTGTCCTCTCCCTTTGCTGCCTCGGACCAGCCGAAGAAGC
AGGCATCGGAGACACCCCGAACCAGGAGGACCAAGCCGCTGGGCATGTGACTCAAGGTCAGTGGCCCAAATCGACTTTGG
GACTCAGATTGGGAGGAGGGAGATGGGAGCACTCAGTGGGCTCTACCTTGAAAAGACATCTTANCGCCAGGTCCTAGGGC
ACAAGTTCAGGAGACCCGAAGGAGTTGCCAATATCAAAGTTGGCCTCTGTAGACACAGACAGCGTTTTCTTATACCATCC
TGGTTCAGGTCATGCCTAGCCCGGGGATGAGGCCAGTGGGTGACNCTCCCACAGGGTGCCCTGTGGCCTGTCAATCNCAT
CACCNATGCNCTTGTCATTCNAACTTCCTTCTCTGCAGTCTTCACACCTTATTANGATTTTCTTCTN
Sequence Type genomic DNA
Unitrap ID UNI30785

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104156103..104156568 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es