Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A016D03
Clone ID A016D03
Vector pT1betageo
Project ggtc

Sequence tag A016D03
Sequence
ACTAAGAAAATAGAGAAAGATGAGAAGAACGACGATGGTCCAAGTGGGCAGACTTCAGAGTCCCTGAAAAAGAGTGAAGA
GAAGAAGCGGATAA
Sequence Type mRNA
Unitrap ID UNI12428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70428044..70428137 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032212 (Sltm) NM_025690 SAFB-like, transcription modulator Gene [Source:MGI Symbol;Acc:MGI:1913910]

 
Come back to gene ENSMUSG00000032212


For any suggestions or comments, please send an email to unitrap@crg.es