Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14605A9
Clone ID IST14605A9
Vector VICTR74
Project tigm

Sequence tag IST14605A9HMR1
Sequence
TCTAAGTGCATTTTTAGACTCACCTATTTTATCCTTCAGGGGAGGTGGCAGAAGGTTGTCCAGCTGACAAGGAACGGCAT
TATAACCGTCAGACAGTTTACTGTTTGGTCTCACTACTTGGCAGCAGTCAGCATAGTCCTGGGCCCTAAGTAGCCAGATC
NAATCTACTGTGCAGTAATTTTATAANTAANCCATGCANCCCANTACACTCACTTCTGTGGTCACTCANAGTTGATGGTA
NGTAGTGGTCNGNTAGTANATGGACTGGGCACTGGCATCN
Sequence Type genomic DNA
Unitrap ID UNI29651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42270229..42270507 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037287 (Tbcel) NM_173038 tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]


Sequence tag IST14605A9HMF1
Sequence
AGAAGAGATTAGATCTGTGAAGGATAAATCTCCATTTTTTATTTCTTGTAATCATTATTAAGTTTCATGAGGACACACAT
TACTAAACAAATGAAAGATATCCTTTCACAAAGGGTACTTGCCTTTATAAAATTTAGGCCTTAAATTATTAAAGATGATC
ATGAAAGATATAATCTCACTGAGTTACTACAATAAGGATTAAATAATTTAGACTTGTTTTCAAAAAGTAGAAATTGAAAT
TTTTCCTAATTTGATTCAAGCCTATGGACTAAATGACAATGCCGTGATTATCAACATAATAAAAGCATCTTCAAGAAAAG
AAAGCCTTATCACTGCAATAATGCCATAAGCCAATCAGGAAACTTAGCATGTAGACGTCACTGAACTAAGTGATTCTCTC
CTGATAAACAGCTCTGCGATGTGTATGGCAAGGCCAGCTCTAATGCNAACAATCTCCTAAAAGATTATCTTCAATACTTT
CNNACCCATTCTGCATGTCTTCCANGTCTCANANCCATCTGTTTGCCNANTGTATCTGCANGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42270505..42271047 525
 
EST/CDNA Est Name
  BI854653.1 - CX731519.1 - BG243973.1 - BB627885.1 - BB616369.1 - BU505316.1 - BB659669.1 - BE911979.1 - BB847425.1 - CJ184554.1 - CJ184895.1 - BY129926.1 - BY153129.1 - CF538084.1

 
Come back to gene BI854653.1 - CX731519.1 - BG243973.1 - BB627885.1 - BB616369.1 - BU505316.1 - BB659669.1 - BE911979.1 - BB847425.1 - CJ184554.1 - CJ184895.1 - BY129926.1 - BY153129.1 - CF538084.1


For any suggestions or comments, please send an email to unitrap@crg.es