Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A008F03
Clone ID A008F03
Vector pT1betageo
Project ggtc

Sequence tag A008F03
Sequence
GGGTTCAGTTNNNTTCTATCNNNGGGCAGTTCACAGGGAGCACAGGAGTGCAGGTCCTGACACAGGAGCAGCTGGCCAAT
CCTGGGGCCCAAGCCTGGATTAAAAAGGATCAGTTCTTAAGAGCAGCCCCAGTGACTGGAGGAATGGGAGCTGTTTTGAT
GAGAAAAATGGGCTGGAGAGAAGGAGAAGGATTAGGAAAGAACAAAGAAGGAAATAAGGAACCCATCCTTGTTGATTTAA
GACAGACCGAAAA
Sequence Type mRNA
Unitrap ID UNI11796

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91671604..91675792 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022961 (Son) NM_019973 Son DNA binding protein Gene [Source:MGI (curated);Acc:Son-001]

 
Come back to gene ENSMUSG00000022961


For any suggestions or comments, please send an email to unitrap@crg.es