Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14228C8
Clone ID IST14228C8
Vector VICTR74
Project tigm

Sequence tag IST14228C8BBF1
Sequence
NAGAGGCTTGGGATTGCTGCAAGTTCTAGGCCATCTTTACTACATAGAAGGAGAGAACCCACTACTGGCGACATCGGGCC
ACACACATGAACACACACACACAGCGGCACGGGTTGCTTGGGAACCCTTCCCTTCCTCCTCAGCGTCACAACAAAGTGAA
AAATAAACTGGCTGCAGTGGGAATGCGCAGCACTCGGGAGGCAGAGAAAGGCAGGCAGAGCTCCGAGTTCCAGGACAGCC
TGGTGTACAGAGAGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACTGTCTCAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3368052..3368358 307
 
EST/CDNA Est Name
  BF467115.1


Sequence tag IST14228C8HMF2
Sequence
ATCCATGTCCCTCTTCCCACCTCAAATCCCCAAACTCTGGCCTCTTTCAAGGGCCCGTTCTCCCCCTTGGACAGATTGGG
GGGGGGCGGGGGAGGTCGCCANAAAACCGCCCATCCCACTCCCTTTATTAGGGGAGGAGGGCGAGGTANCACANTGTTC
Sequence Type genomic DNA
Unitrap ID UNI13503

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3367401..3367559 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069806 (Cacng7) NM_133189 calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]


Sequence tag IST14228C8HMR1
Sequence
GGATGAGAGGGAGTACCAGAAAATGGAAGACGGAGGTTTTGGGGGGTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3367355..3367404 50
NO GENE  

 
Come back to gene ENSMUSG00000069806


For any suggestions or comments, please send an email to unitrap@crg.es