Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14922A11
Clone ID IST14922A11
Vector VICTR76
Project tigm

Sequence tag IST14922A11HMR1
Sequence
TTTTATTCTTAAAAGTATAATCAGCTGTGTCAAACTGACTCTGCCTCCANATACTGAAAGAATTTCTAGTGATAAAAATT
AAGTCAGAATTGATTTTTGTATGTGTGTGTAAATTGGTCTTGTAAGTAACTGTTATAACTAAATTACAATAATGAACAAT
AATGATGGTGACAATTACGAAAATGATGATTGATGATGATGATTATGANATAAAATCTCACTATGCAGCCCTGGCTGTCC
TGGACCTTACTATGTANACCAGGCTGGCCTTGAACTAANAGAGCCNTTTGCTTCTACCTCCANAGTATGCCACAGTGTCN
GGGACATANCTNGATTAACTTTTTTTTTNNNGNTTN
Sequence Type genomic DNA
Unitrap ID UNI22841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70322935..70323282 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


Sequence tag IST14922A11BBF1
Sequence
CTCTGTACTTCCTGAACGCCAGTCTCTCCCACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 33293074..33293111 38
NO GENE  

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es