Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14419B4
Clone ID IST14419B4
Vector VICTR74
Project tigm

Sequence tag IST14419B4HMR1
Sequence
GCTCATCACCCTTCCNGAGGCCGAGAGTTATGGCTAGGGTGTGGCATGCGTTTTTCTGAGAACCTGACACGTGGGGCTGC
AGGGATTGTTCAGCTGGTCANNNTN
Sequence Type genomic DNA
Unitrap ID UNI17568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95168988..95169087 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]


Sequence tag IST14419B4HMF1
Sequence
GAGCCATGAAGATTACTTTACCTAGTAAGCACTGACACGTGCTCTTTTCTAAGCTGGACAAAGAGTACTTGCTGAAATCA
CTACAACTCCTCAAACTCAGTCCTACTATCTTTGGCAGGAAAAGGGAGTGGGACAGACGAAGGACTGAACTCAGGGCTTC
CCGGCAGTAACCACACCCCACTGAGCTATAGCTTAGTCCCAGGCCCCAACGCTTTATTCAAAGAATAAGCTCCCTGGGGC
CAAGTATGTTTGGAGTTACTAGATTCTTACAGAGGACACATATATCCTGTGATTAACAACCCACACTAAAAACATTAATA
TTTTCTAGCAAACAGAAATTTAGTATCACACTACATGAGGCATATAAAAAAACTAAANTAACCTAAGGNNAGATTAGGAC
AGATTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95169084..95169492 402
 
EST/CDNA Est Name
  CF900296.1 - BQ890895.1 - CF897706.1 - BG808984.1 - CF739264.1 - CN672058.1 - CF907861.1 - CN704789.1 - BI221071.1 - CD553281.1 - CF164947.1 - CN682294.1 - CN681300.1 - CA568662.1 - CA880911.1 - CN674244.1 - CN669013.1 - CF171609.1 - CA872928.1 - CD539373

 
Come back to gene CF900296.1 - BQ890895.1 - CF897706.1 - BG808984.1 - CF739264.1 - CN672058.1 - CF907861.1 - CN704789.1 - BI221071.1 - CD553281.1 - CF164947.1 - CN682294.1 - CN681300.1 - CA568662.1 - CA880911.1 - CN674244.1 - CN669013.1 - CF171609.1 - CA872928.1 - CD539373


For any suggestions or comments, please send an email to unitrap@crg.es