Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10780B3
Clone ID IST10780B3
Vector VICTR76
Project tigm

Sequence tag IST10780B3HMF1
Sequence
CTCTTATAACCTAGGCTGGTCTCAAACTCAAGATCCTCCTTGTCTTGGCCTCCCAAGTACTGGGACTGCAGCCAGAAGCC
AGCCTGAAAGCCTGAGGTAATAAGGGCCAGAAGCTGGTGGGGGTGGCTGCACGCCTCTGATCCAGAGCTAAGGCTGAGGC
GGGAAGATTGCCAAGAGTTTGAGAACAGTCTAGGCTACAAAAGGAGCTACAGTGTGAAGCCTTGTCTCCCAAACAAACTA
AACAAACAAATACAGACACAGGCGCCCTAACTGTANGAAACACTGTCTAGTAGGCCCTAAGTACCCATAAATGATTGCAG
CTGANAGTCAGGCTCTCNNTGTGGATGTTAGGGAATTCGAGAAGATTCTGAGTCCANGCCTGAATGCTGAGTCNTGTTTA
TCANGGTTAGAGTGGGGGTGTTCCANATAGATGTAGCAATTCNNCAATAGCATGCNACACAGGGGAATTCAAAGCACN

Sequence Type genomic DNA
Unitrap ID UNI33178

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95050672..95051149 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028115 (Bnipl) NM_134253 BCL2/adenovirus E1B 19kD interacting protein like Gene [Source:MGI (curated);Acc:Bnipl-001]


Sequence tag IST10780B3BBF1
Sequence
CTCTTATAACCTAGGCTGGTCTCAAACTCAAGATCCTCCTTGTCTTGGCCTCCCAAGTACTGGGACTGCAGCCAGAAGCC
AGCCTGAAAGCCTGAGGTAATAAGGGCCAGAAGCTGGTGGGGGTGGCTGCACGCCTCTGATCCAGAGCTAAGGCTGAGGC
GGGAAGATTGCCAAGAGTTTGAGAACAGTCTAGGCTACAAAAGGAGCTACAGTGTGAAGCCTTGTCTCCCAAACAAACTA
AACAAACAAATACAGACACAGGCGCCCTAACTGTAGGAAACACTGTCTAGTAGGCCCTAAGTACCCATAAATGATTGCAG
CTGAAAGTCAGGCTCTCNATGTGGATGTTAGGGAATTCGAGAAGATTCTGAGTCCAGGCCTGAATGCTGAGTNNTGTTTA
TCAGGGTTAGAGTGGGGGTGTTCCAGATAGATGTAGCAATTCAGGCAATAGCATGCAACACAGGGGAATTCAAAGCACAA
AGCCTGACTGTATATGAAGGGCTGGGAGGCANANGAAGAANATCAAAAGATAGAATNGACTCCNCCAAN
Sequence Type genomic DNA
Unitrap ID UNI33178

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95050602..95051149 532
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028115 (Bnipl) NM_134253 BCL2/adenovirus E1B 19kD interacting protein like Gene [Source:MGI (curated);Acc:Bnipl-001]

 
Come back to gene ENSMUSG00000028115


For any suggestions or comments, please send an email to unitrap@crg.es