Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10129G4
Clone ID IST10129G4
Vector VICTR76
Project tigm

Sequence tag IST10129G4HMF1
Sequence
TTGGGGTCAGCCCCCAGCAGGAGGAGTGAAGGGAAAAGACGTCTGAGTCGGTTTTAGATTCCCGGCAATCACCTAAAGCT
AAGCTTTATATCCTGCTGATTTCAGAATATTTCNCAGTGTCACCTACAAGTTTAGGGTTGGGGACCAGATAAATTTAAGT
CCGAGCATCTGGGAGAGCCCACAGAGTCAGTATTTATACAGTATAAAGTTCTTCAATTCCNCCTGTTTGCTGGAATACCA
AATCAAGGCAGTGTANGGCANGGGCCTTGAGTGGGTTNATTTTCTCACCANTTAANGAATTAANAGGAGTCGGGCANTGG
TGGCGCACGCCTTTAATCCCAGCACTGGGGAGGCAGANGCNGGCGGATTTCTGAGTTTGAGGCCNNCCTGGTCTACAAAG
TGAGTTCCANGACAGCCNNNGCTNTNCNGAGAAACCCTGTCTCCCGGTCTCGAAAGANNGAAACAAACAAACAANA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10129G4BBR1
Sequence
AAGTTCCACCAAAAATCAAATCTAAATTGAGAGAGAAGTTCACAACAGAGAATGGTTATTAGTAAAACTATATTGGCGGG
TGTTTAATTTGGGCAGGTTAGCTTGAGCCAGTGGGTAATGAATTCCCATTTTAGGATCTGTGTTATGAAATATGTGCAAT
CCTTGGTGACATATTTAAGTAATCTCATAAATATAAACTCATGCCATTAGCTGTAGCTGTGTGTGTCACATTATAGATCC
Sequence Type genomic DNA
Unitrap ID UNI33179

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177762748..177762988 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074519 (Etohi1) ethanol induced 1 Gene [Source:MGI (curated);Acc:Etohi1-001]


Sequence tag IST10129G4BBF2
Sequence
TTGGGGTCAGCCCCCAGCAGGAGGAGTGAAAGGAAAAGACGTCTGAGTCGGTTTTAGATTCCCGGCAATCACCTAAAGCT
AAGCTTTATATCCTGCTGATTTCAGAATATTTCGCAGTGTCACCTACAAGTTTAGGGTTGGGGACCAGATAAATTTAAGT
CCGAGCATCTGGGAGAGCCCACAGAGTCAGTATTTATACAGTATAAAGTTCTTCAATTCCACCTGTTTGCTGGAATACCA
AATCAAGGCAGTGTAGGGCAGGGGCCTTGAGTGGGTTCATTTTCTCACCAGTTAAAGAATTAAAAGGAGTCGGGCAGTGG
TGGCGCACGCCTTTAATCCCAGCACTGGGGAGGCAGAGGCAGGCGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAAAG
TGAGTTCCAGGACAGCCAAGGCTATACGGAGAAACCCTGTCTCCCGGTCTCGAAAGAAGGAAACAAACAAACAAGAAAAA
AGAATGAAAAAGAATGAAAATCTCTGGCTCAGCAGGTAGCAGCTTGAAACACAGCAGGCAGAATTAGCATGTTTTTAGCA
TGTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 56837692..56838253 560
NO GENE  

 
Come back to gene ENSMUSG00000074519


For any suggestions or comments, please send an email to unitrap@crg.es