Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13763A1
Clone ID IST13763A1
Vector VICTR74
Project tigm

Sequence tag IST13763A1HMF1
Sequence
TTTGGAGCGAGACGCTGCGCCGGAGGTAGGCGCTCTCGAGGGTGGCCTCGGCACCAGCGAGGTTGTGGGCGTAGTGCGGG
TTTAGTGGCGGGAGTGGCGGCCTCGAGGAGTGGGACGCGAGCGGCGTGGAGCTTGGGGTCCCGGCCTTGCCACCCTCGGG
GTCGCTCCANCTCCACGTANCGGTTGCCCCGGGGTCCCCNNNANGGCCCNGGAANAA
Sequence Type genomic DNA
Unitrap ID UNI33180

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20002935..20003145 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037315 (Phf16) NM_199317 PHD finger protein 16 Gene [Source:MGI (curated);Acc:Phf16-001]

 
Come back to gene ENSMUSG00000037315


For any suggestions or comments, please send an email to unitrap@crg.es