Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13570D5
Clone ID IST13570D5
Vector VICTR74
Project tigm

Sequence tag IST13570D5HMR1
Sequence
ATGAGAATTAGGTGTAGTGAAATATTCTACCTCTGAGATAAACTGCTATCACATTTGGATACTGTGCTNATAAATTACTA
TTTACCCAGCACTAGTTTAATTGTAGTGCTAAGTACTGTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI33185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155970619..155970741 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067847 (2010100O12Rik) NM_025946 reactive oxygen species modulator 1 Gene [Source:MGI Symbol;Acc:MGI:1914317]

 
Come back to gene ENSMUSG00000067847


For any suggestions or comments, please send an email to unitrap@crg.es