Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A020A03
Clone ID A020A03
Vector pT1betageo
Project ggtc

Sequence tag A020A03
Sequence
TTTCTNNNNCTTATCCCAATTTCTTTTCTCTATCCCAANNNTAAANNNNTTTCCCATCCGCTTGTGCCCCTTGCTTTTCA
GGTTTGAGAAACCCCCCAAGGCCTCTCTTGGTGGCTGGTCCCTCCAGCACAGGAAGCAGTGACTCAGATGGTGGCCTCTT
TGCTGTCCCAACGACTTTGCCACCAAATAGTCGACATGGAAAGCTCTTCTCTCCCA
Sequence Type mRNA
Unitrap ID UNI12437

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 25114488..25116462 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038002 (Cramp1l) NP_065633 Crm, cramped-like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1930190]

 
Come back to gene ENSMUSG00000038002


For any suggestions or comments, please send an email to unitrap@crg.es