Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A027A06
Clone ID A027A06
Vector pT1betageo
Project ggtc

Sequence tag A027A06
Sequence
ATACAACCCTCTTTTTGTCTCGACTCAACACGATTTGGAAAGGATTTATTAATATGCAGAGTGTAGCAAAATTTGTCACT
AAGGCATATCCTGTCTCTGGGTGTTTGGATTATCTCAGTGAGGATTTGCCAGACACCATCCACATCGGTGGAAGGATTGC
TCCAAAGACCGTGTGGGATTACGTTGGCAAACTCAAGTCATCGGTGTCCAAGGAGCTCTGTGTGATCCGCTTCCCCCCTC
CCACTGAGGAGGAGGAGTTTGGATACATTTCTCTCTACTCCTATTTTNNCAGTCTGTGGTCACTTTGGGGTTGTAGCTAA
TAACAACAGGCATGTCAAGTACCTGTACCTGATTCCCCTAAGAGCTAAGGACCGTGTGCCATCCTCACTCTTCCCCTTAG
AAGACCCAG
Sequence Type mRNA
Unitrap ID UNI12442

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180404096..180405687 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es