Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A019C05
Clone ID A019C05
Vector pT1betageo
Project ggtc

Sequence tag A019C05
Sequence
AANNNAAAAAAGAAAGGGAGGGGGGGTGTAGCCCTGATNNNGGATGACTTCCAGATGGAAGCCTTACAGTTCGCCCTCAC
CAAGGAGCTGGCTATCATTCAAGGACCTCCTGGAACAGGCAAGACTTACGTGGGTCTAAAAATTGTTCAGGCTCTTCTGA
CCAATAAGTCTGTTTGGCAAATTAATACCCAGACATTCCCCATCTTGGTGGTGTGTTATACCAATCATGCTTTGGACCAG
TTTCTGGAAG
Sequence Type mRNA
Unitrap ID UNI9781

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166875814..166880742 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039501 (Znfx1) NM_001033196 zinc finger, NFX1-type containing 1 Gene [Source:MGI (curated);Acc:Znfx1-001]

 
Come back to gene ENSMUSG00000039501


For any suggestions or comments, please send an email to unitrap@crg.es