Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10494H6
Clone ID IST10494H6
Vector VICTR76
Project tigm

Sequence tag IST10494H6HMR1
Sequence
GGAAAAACAAACAAACAAACAAACAAACAAACAAAAAAACCCTTAGCTTTCATGTAATTTCAGTTGTTGAAGATGTTTCA
TCGTGACAAATTTAAACTCCTCTGAGCTTGTAGCCTTTCCTAGATGTTTATCCAGATGAAGAAAAAATGACACTTATTTT
GAGACTAAGCTTTGAGAAAATAATTATACAGTACTTTCCCCTTGTGTTTTTCTTTCCAGGCTCTTTCTCAACCATGACCC
CTAAATATTAATATTTGTTTTGACNNAAGAGGAAAAAAACATAAAATTGCTTACTTTGTTATAATTGTTCTATTTTATTA
TTGTTTTTAATTGTGCGTTGTGTTTAATTTATAAATCAAACTTTANNNNNNACNAGTGTTACNAGANANCTACNGTTCAT
GCTGTATAAGGGTN
Sequence Type genomic DNA
Unitrap ID UNI33186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34717474..34717886 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028295 (1810030N24Rik) NM_025471 RIKEN cDNA 1810030N24 gene Gene [Source:MGI Symbol;Acc:MGI:1913541]


Sequence tag IST10494H6BBF1
Sequence
CAGACAGGGTTTCTCTGTGTAGCCCTGGCTATCCTGGAACTCATTNNGTANACCAAGCTGGCCTGGAACTCANAAATCTG
CCTGCCTTTGGCTCCCGAATGCTGGGATTAAAGGCGTGCCCCACCACGCCCAGCTCAGCTAAGGGTTTTTAAATACTTTA
ATGACTTANTTAANTTGATTANCTTTAGAACAATTTATAGTCACAACTATTATTAAAATTCATATCNAGTATGAAATAAT
TCANTAATTATCATATTTAAATTTTTATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34717886..34718154 251
 
EST/CDNA Est Name
  AA967935.1 - BG100210.1 - BU938248.1 - BE850877.1 - AA607472.1 - AA060440.1 - BY329823.1

 
Come back to gene AA967935.1 - BG100210.1 - BU938248.1 - BE850877.1 - AA607472.1 - AA060440.1 - BY329823.1


For any suggestions or comments, please send an email to unitrap@crg.es