Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15051G10
Clone ID IST15051G10
Vector VICTR80
Project tigm

Sequence tag IST15051G10BBF1
Sequence
ATATCTACCANTGTTTTGCCTGCATGTATGTCTGGGTACGGAGTGTGTGTCTGGTGCCCACNGAANCCAGAAGAGGTACC
ANATCACTANAAACTAAAGTTACAGACAGTTGTGAGCCTCCATGTANATGCTAGGAATCAAACCTGGGGCCTCTGGAAGA
GTAACCAGTGCTCTTAACTGAATCTCTATCCCAGCATTGATCTTTGAATCATCTGTTAACATCTGGAAAGCATTTAGGAA
CAAGCTGATGCAGGTCTACCAGGGACTTGGAAAGTTTAACAAAAATATGGTCTGTCTTATTGTTACAGTTATTTACNAAC
TTGGGAAGTAGGCTCTCTGTCNTTCAATTNCAGTTCACTTTCCTTACACTAANCAGGANGCCCCGANGGGAGGGGGGATG
GAN
Sequence Type genomic DNA
Unitrap ID UNI31828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88371302..88371703 378
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008604 (Ubqln4) NM_033526 ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]


Sequence tag IST15051G10HMF2
Sequence
CCCACAACTCACAGCCCANATGCTTCCTGGCCCCACCTCCNTAACCTANNANAGGAAGGAAGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15051G10HMR1
Sequence
TGGGTTGTTCACTTTTGAGGTTCAGGGTCTANCTCCTTTAAACNNNCNGCCTGCGGTGGCNGGNGTGTGGACATGTAGAC
ATGGAACAAAGTCCTAGGGCCAACAGTCTTTTCTCAGGGTATGGAGGGACTGGAGCATCCTAAGCGATACCCACTGACTT
CTCAGTACTAATACTTGAACAGAGCTCCGGTTTACCCAGAGCAGTGGTTCTCAAACTGTGGGTAGTGACCCCTTTGAATA
TCACATAATTACAATTCATAATAGTAGTGGGGAAAAAAAGAAACAATTATAAAGTTGCAACAAGCCAGGCGTGGTGGCGC
ACGCCTTTAATCCCAGCACTTGGGAAGCAGANGCAGGCAGATTTCTGAGTTCCAGGTCAGCCTGGTCTACAGAGTGAGTT
CCAGGACAGCGAGGGCTACACAGAGAANCCCTGTCTGGAAAAACAAANNAACAAATAAATAAATAAAGTTGCNNCAAAAN
AATAATTTTATGGCTGGGGANCACCNCNNCATGAGGAACNATNTTAAAGGATGGCAACATCN
Sequence Type genomic DNA
Unitrap ID UNI14557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108487663..108488202 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006675 (4933406E20Rik) NM_028944 RIKEN cDNA 4933406E20 gene Gene [Source:MGI Symbol;Acc:MGI:1921693]

 
Come back to gene ENSMUSG00000006675


For any suggestions or comments, please send an email to unitrap@crg.es