Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14996G12
Clone ID IST14996G12
Vector VICTR78
Project tigm

Sequence tag IST14996G12BBF1
Sequence
ATCTCCCCACAGGAGCTCTGGGAGCCTTCACAGAAGGTGATTCAAACTCCCGGTTGTTACTCTCCAATGGAAAAGACTTA
CCCACTGAGCCACCTCCCAGGCCCTGAACCGGTTCATGTCGCCTCTTTAACCATTGAGTTAAAAAGAATCAGTCCAGTGG
ATTGGGCTAAGGTGTACATTCTCTGCTAATCTCAAAACTGGCCTTGGAAAGCAGGGGTAGCCGCTCTCTCCTAAATAACT
CTTAGAAAAAAGTAAGCAATTGCTGAGGTTAACCTCCACTAAAGTGATTAAATTGGAGTTCCCACCCTCCCATTGCCTGA
TTCTAAACCTCTCACCTTATCCTTATTCCTCTTTNANGTAAAAGCTTCTAANAN
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57292573..57292943 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]


Sequence tag IST14996G12HMF1
Sequence
ATCTCCCCACAGGAGCTCTGGGAGCCTTCACAGAAGGTGATTCAAACTCCCGGTTGTTACTCTCCAATGGAAAAGACTTA
CCCACTGAGCCACCTCCCAGGCCCTGAACCGGTTCATGTCGCCTCTTTAACCATTGAGTTAAAAAGAATCAGTCCAGTGG
ATTGGGCTAAGGTGTACATTCTCTGCTAATCTCAAAACTGGCCTTGGAAAGCAGGGGTAGCCGCTCTCTCCTAAATAACT
CTTANAAAAAAGTAAGCATTGCTGANGTN
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57292675..57292943 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]


Sequence tag IST14996G12HMR1
Sequence
GANGTGAGGCAGAGACAGAATTTCCNGAAGCTCAGGGGCCAGTTCACCTGGAATACGGTACAGANAAGTGGAATGCAGAA
GAGAGACCCTGATCTCCAACACGGAAGGATGCCAAGCGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57292941..57293060 114
NO GENE  

 
Come back to gene ENSMUSG00000038764


For any suggestions or comments, please send an email to unitrap@crg.es