Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14990D2
Clone ID IST14990D2
Vector VICTR78
Project tigm

Sequence tag IST14990D2HMR1
Sequence
GTATCTGCGTTACTGCGGCCTCACTATGCTAATCAGGTTTACTGCAAAGTGCTGCCTGCATGCTCCTTTATCCTTACAGC
CTTGTGATACGTTCAGAACTGACATGTTCGCTTTCTGTCGCTGCCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI24232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35093528..35093656 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066571 (4931406P16Rik) NM_172741 RIKEN cDNA 4931406P16 gene Gene [Source:MGI Symbol;Acc:MGI:1924311]

 
Come back to gene ENSMUSG00000066571


For any suggestions or comments, please send an email to unitrap@crg.es