Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11501G7
Clone ID IST11501G7
Vector VICTR76
Project tigm

Sequence tag IST11501G7BBF1
Sequence
TGCTCATGTTTGCTTGCTTTTGTTTAAAGCAAGAACTTACATGACACTTAGTATATGACAACCACTCTACCAATACCTTT
ACCAAATGTCACTTTAATTCTCATGCAATATTTTTACATTANTATTAATATTTCAATTTANAAATGAAAAATTGAAACAA
GAAGATGTTGAATTTTTCCCAAGTCTAAACAGCTAGTTCATGTGAGGTTAGGGATTTAGCTCTAGGAAGTATATGCCTAT
NNTCTTANCTCTATGCTGTTATTCCANGTGAATAGTCTATCATATANAAATGTGACTTCTATATATTGTTATGGTTTCTT
TTGTCATCACTGGAATAAAATAACNTGACNNANGTAACGTANAGGANGGAANGTTCATTTTGGCCCTGGTTATCANTGAT
ATGGTCCATCATGGGANGAANGCATGGCAGTTGGTCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI19251

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41475761..41476202 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022307 (Oxr1) NM_130885 oxidation resistance 1 Gene [Source:MGI Symbol;Acc:MGI:2179326]


Sequence tag IST11501G7HMF1
Sequence
TGCTCATGTTTGCTTGCTTTTGTTTAAAGCAAGAACTTACATGACACTTANTATATGACAACCACTCTACCAATACCTTT
ACCAAATGTCACTTTAATTCTCATGCAATATTTTTACATTANTATTAATATTTCAATTTANAAATGAAAAATTGAAACAA
GAAGATGTTGAATTTTTCCCAAGTCTAANCAGCTAGTTCATGTGAGGTTAGGGATTTANCTCTANGAANTATATGCCTAT
NNTCTTNNCTCTATGCTGTTATTNCNNGTGAATAGTCTATCATATANAAATGTGACTTCTATATATTGNTATGGTTTCTT
TTGTCATCACTGGAATAAAATAACNTGNCNNATGTAACGTANAGGANGGAANGTTCATTTTGGCNCTGGTTATCANTGAT
ATGGTCCATCATGGGANGAANGCATGGCAGTTGGTCTGGATCCTTCTGTGTTACNNGGGTATGANGCAATAGCCNCATGT
NCTCACATCTGGNANANCANTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022307


For any suggestions or comments, please send an email to unitrap@crg.es