Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12658G11
Clone ID IST12658G11
Vector VICTR76
Project tigm

Sequence tag IST12658G11BBF1
Sequence
ACTTAAGGCTTTTAAAGTTTTGGGGAACTGAGGGTAGGACTTTCAGGATAGGCAAAGATCATTGGCTGGGAGTTTAGGGT
ATCTGGAATGTCTCATTAATATGGGGAAGCATTCTAGGAATCTCAGGTCCGGGAATCTAATTGAGGCTACATGACATTCC
TCAGGGAATGAGACAGGGTCCTAATCTCCTCACTATAGGTCAAANAGTCAAAGCTCANCCTTGGCTGGANGGCTANANAA
ACCCTGTTTCCNAAAACAACNNCAACAACNNCN
Sequence Type genomic DNA
Unitrap ID UNI31544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95771629..95771897 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013418 (B4galnt2) NM_008081 beta-1,4-N-acetyl-galactosaminyl transferase 2 Gene [Source:MGI (curated);Acc:B4galnt2-001]


Sequence tag IST12658G11HMF1
Sequence
ACTTAAGGCTTTTAAAGTTTTGGGGAACTGAGGGTAGGACTTTCAGGATAGGCAAAGATCATTGGCTGGGAGTTTAGGGT
ATCTGGAATGTCTCATTAATATGGGGAAGCATTCTAGGAATCTCAGGTCCGGGAATCTAATTGAGGCTACATGACATTCC
TCAGGGAATGAGACAGGGTCCTAATCTCCTCACTATAGGTCAAAGAGTCAAAGCTCANCCTTGGCTGGNGGGCTAGAGAA
ACCCTGTTTCCAAAAACAACAACAACAACNACAAAAACNNAAAAAACNNAANNAAACCAAAACAAACCAAANCANANCAN
ANAAACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000013418


For any suggestions or comments, please send an email to unitrap@crg.es